mkim8733 mkim8733

13-12-2022
Engineering

contestada

Given the text T and pattern P below, count the number of comparisons necessary for searching for P in T using the KPM pattern matching algorithm. Also, show the failure function and the compares at each step in a tableT = CAGGAGAGGAGGTTGGAGGAP = GGAGGA

Respuesta :

Otras preguntas

You are an office manager and need to get the mail out by 3:00 P.M. each day. To do this you need 30 minutes to write checks, 20 minutes to prepare envelopes an

A shipment of 15 cases of socks is received from the vendor. Each case contains four boxes. How many boxes of socks have been received? 30 45 60 75 120

The last great empire centered in Southwest Asia was the _______ Empire. A. Byzantine B. Mongol C. Ottoman D. Roman

a radio station requires DJs to play 2 commercials for every 10 songs tgey play.what is the unit rate o songs to commercial?

I need help with a problem 2.Write a justification for Line 2, Line 3, and Line 4. Explain why you chose each justification. Line 1 5x – 2 = 3x + 7 Line

If y varies inversely as x and y is 1.5 when x is 8, what is y when x is 2

A group of people who settle far from home but keep ties with their own country

describe a real life multiplication situation for which an estimate make sense

A latitude of 75 degrees and 20'S would be closest to a the south pole b the North Pole c the equator and d Canada?

A mutation changes the DNA sequence AAGCCTGGCAAT to the new sequence AAGCCTGCGCAAT. What kind of mutation has occurred? A. deletion B. insertion C. duplication