aleykrptc aleykrptc

13-05-2023
Mathematics

contestada

bir kare ve dört eşkenar üçgenden meydana gelen şeklin çevre uzunluğu 72 cm olduğuna göre karenin çevre uzunluğunu hesaplayınız

Respuesta :

Otras preguntas

A car recently sold for $32,345. If there's a 6% sales tax on automobile sales, how much tax will be added to the price of the car? A. $1,940.70 B.

Increased carbon dioxide levels in the atmosphere will most likely lead to

Integrity for handling the finances of others is a basic qualification of the1.Planning career path.2.Taxation career path.3.National Service career path.4.Admi

Choose the answer that best completes the sentence. Paco _________ su tarea cada dia a las tres. Question 4 options: empeza empieza empiezo empezar Question 5 (

What is the density of an 800 gram object that occupies 200 cm 3 ?

How does the oxymoron "controlled chaos" affect the meaning of this sentence? She sat back and put her feet up, grateful to relax after the controlled chaos o

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

How is Romeo and Juliet more than a play about love but also one about politics?

Question 13 Unsaved ______ is a condition that can begin when the cartilage that pads bones in a joint begins to wear down.

If a mineral breaks into cubes when struck with a rock hammer whats being measured