ameijennCowwilk ameijennCowwilk

15-05-2016
English

contestada

If the following sentence contains a simile, choose the option that contains the entire simile. If there is no simile, then select "none."

He came home in a temper.

He came home in a temper.
home in a temper
in a temper
none

Respuesta :

Аноним Аноним

15-05-2016

There is no simile because the sentence does not have like or as. Therefore, the answer is none. Good luck!

Answer Link

Bailey520 Bailey520

15-05-2016

Id say none. A simile is a comparision and his temper is not being compared to anything.

Answer Link

Otras preguntas

Think of a recent conflict you have had with a colleague, friend, or family member. Using the principles of conflict resolution that you have learned in this le

Plz Help Me Asap!!!!

which fraction is eqvalant to 5\10

why do plant celss have chloroplasts and animal cells not?

AKIO and 7 friends will share 3 liters of juice equally. How much juice foes each person get?

Maria is purchasing a new car whose MSRP is $22,450. She is trading in her old car for $7000 and being upgraded to a premium package for $4000. Vehicle delivery

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

The short-run phillips curve shows that, other things remaining the same, _______.

Please help with graph question

Which of the following was one of the major issues that caused the colonial governments to become unhappy with the British Parliament? A. The British impose