kaylee6893
kaylee6893
12-09-2019
Mathematics
contestada
I need help with this question thanks
Respuesta :
visionistprojects
visionistprojects
12-09-2019
Answer: C (h = V/(pie)r^2
Step-by-step explanation:
Answer Link
VER TODAS LAS RESPUESTAS ( 99+ )
Otras preguntas
Katie is in high school. What is the best example of how she can be proactive about her health and wellness? Go to the dentist regularly. Whiter teeth will hel
Which of the following relations is not a function? {(0, 0), (1, 0), (2, 0)} {(-1, 3), (4, 2), (-1, 5)} {(1, 2), (3, -5), (-1, 7)} {(7, -1), (3, -2), (5, -2)}
complete the solution of the equation. find the value of y when x equals -1. 8x - 2y= 10
If a cell is placed inside a solution that has a higher concentration of solute than on the inside of the cell, what can be said about the movement of water?
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
3. Whether they be human, divine, or monstrous, female figures in The Odyssey are surprisingly strong. In your response, compare two or three different female f
A ball is floating partially submerged in a liquid. Which quantity equals the buoyant force acting on the ball? mass of the ball volume of the ball below t
In which column on a check register should the total current amount in the account be entered? Deposit Transaction Balance Debit
In the cell cycle, cytokinesis occurs at the end of A. mitosis. B. prophase. C. interphase. D. G1 phase.
Danielle plotted 3 points from the equation y = 4x on this coordinate grid. She drew a straight line through the points. Which ordered pair would also be on th
