hedgie131 hedgie131

15-10-2020
Biology

contestada

If you have a sinus infection, many times you feel pressure in the check area. What is the regional term for this area?

Respuesta :

isaiahgibson101 isaiahgibson101

15-10-2020

Answer:

Thyroid

Explanation:

Answer Link

Otras preguntas

Why would a person choose to tie a helium-filled balloon to a child's wrist instead of simply having the child hold on to it? A. Helium is less dense than air,

One year the price of a motorcycle $3,000 it increased to $3,550 another year what is the percent increase in its price round your answer to 2 decimal places

an italian bicycle has its frame size given as 62 cm. What is the grame size in inches

How are service animals trained

70 meters increased by80%

DP rule for math because it’s hard

simplify the ratio km : 400 m

There is a net pressure of 28.8 Paacting on a picture window, whichcreates a 43.9 N force on thewindow. What is its area?(Unit = m^2)

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

Michelle and Brian measured the acceleration of a cart rolling on an inclined track with one block under one end, and found that the acceleration was 0.482 m/s2