713sergio 713sergio

15-12-2020
Biology

contestada

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Respuesta :

peppapig200 peppapig200

15-12-2020

UACCGCUCCGCCGCUCGACAAUACC

Answer Link

Otras preguntas

Literal equations: Solve for Y: 3X-2Y=8

what were Greek tyrants like?

what improper fractions equal 17.09 repeating

10.261 divided by 3.1

Many people who immigrated to the United States during the Gilded Age moved to?

jenya deposited $400 into her bank account.a couple of days later she withdrew $50. the next day dhe deposited $20 more. a day later she withdrew $150. write an

how many oz = 7 lb help me please

how to write 12 ten thousands, 8 thousands, 14 hundreds, 7 ones in standard form

What type of climate gives rise to a tropical grassland?

"Two solutions of an equation are (6,5) and (8,5). What could the equation be? Explain."