cheyyy5 cheyyy5

14-01-2021
Biology

contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya angelomontoya

14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

What do ocean waves and sound waves have in common?

Write an expression that can be used to find 4•275 using mental math and properties of numbers

Nitroglycerin (C3H5N3O9) can decompose and is represented by the following reaction: C3H5N3O9 = 6N2 + CO2 + H2O +O2 1. how much nitrogen in grams) forms when 50

A passenger car will go 462 miles on 16.5 gallons of gasoline in city driving. what is the rate in miles per gallon?

A tire company wants to know how quickly the tread on its tires wears down with average use. Have x represent the number of months the tire was used and have y

You have 9/4 cup of jelly worms and a recipe that calls for 1/2 cups of jelly worms. How many batches of your recipe can you make?

What is a scientific hypothesis? In what two ways can a hypothesis be tested?

why did alexandria become a major center of learning?

Which slogan contains alliteration? One Dollar Snacks, Million Bucks Taste Distinct Taste Simply the Best Snacks The Snack You Can Sneak

What is -35 - 2.5x = -100 Solve for X