gemini88173 gemini88173

13-04-2021
Mathematics

contestada

please find the sum or difference of (-37) - (-38)

will give brainliest

Respuesta :

yongren00 yongren00

13-04-2021

Step-by-step explanation:

(-37)-(-38)

=(-37)+38

=1

Answer Link

turkan232323 turkan232323

13-04-2021

-37+38 ( 2 negatives change the sign)
Then sign is positive ( great number-without sign)
The answer is 1 ( positive1)

Answer Link

Otras preguntas

The following chart shows a store’s coat sales for two years. 2 circle graphs. A circle graph titled 2006. Top coats is 297, parkas is 210, jackets is 213, rain

Which statement accurately describes radioactive dating? Geologists use only one type of radioactive dating. Geologists compare parent and daughter elements to

Which letter labels a vertex? A triangular prism. A is a side, D is a side, B is a face, C is a vertex. A only B C A and D THIS ANSWER COME W

What is the answer for -3x+12x

Read the article and use the information to answer the following questions. H1N1 Influenza How is the H1N1 influenza virus spread?

An operon is a:_________. a. region of DNA consisting of the operator and coding sequences for structural proteins, but not the promoter. b. region of DNA con

A powerful computer is purchased for $2000, but loses 20% of its value each year. How much will it be worth 4 years from now?

A paper weight is made in the shape of a triangular pyramid. The dimensions of the paper weight are shown.The formula for the volume of a triangular pyramid is

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Which kind of disaster devastated much of New Orleans in August 2005? O tsunami O hurricane O earthquake O tornado