mckenziewilliams0923 mckenziewilliams0923

13-05-2021
Mathematics

contestada

Plot two points that are 3 units from Point C and also share the same y-coordinate as Point C.

Plot two points that are 3 units from Point C and also share the same ycoordinate as Point C class=

Respuesta :

jayleen5101 jayleen5101

13-05-2021

I think (-3,-5) and (-9,-5)

Answer Link

lelly31 lelly31

13-05-2021

(-3,-5) (-9,-5) should be right

Answer Link

Otras preguntas

On three 150-point geography tests, you earned grades of 88%, 94%, and 90%. The final test is worth 250 points. What percent do you need on the final to earn 93

Students are given 3 minutes for each multiple-choice question and 5 minutes for each free-response question on a test. There are 15 questions on the test, and

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

A plant uses energy from the Sun to make food. What kind of energy transformation is this? A. mechanical energy to chemical energy B. light energy to mech

1. 2 + 5 = 5 + 2 exexmolifies which property? 2. 2*(7*5) = (2*7) * 5 exemplifies which property? 3. 2(x + y) = 2x + 2y exeemplifies whcih property? 4. 2z +

. Which of the following is an example of how a scientist might use a model? Marbles placed inside a hollow sphere are used to describe protons in a nucleus. Mi

What happens when infrared hits a shiny surface

when Target donates 5 percent of its federally taxable income to nonprofit groups, the company is highlighting its what

An experiment consists of casting a pair of dice and observing the number that falls uppermost on each die. (a) Determine the event that the sum of the numbers

if x>2, then x^2-a-6 / x^2-4=