kelbylyn4175 kelbylyn4175

15-12-2017
History

contestada

The destruction of the berlin wall was significant because it __________.

Respuesta :

youngmaurice01 youngmaurice01

15-12-2017

symbolized the end of Soviet repression in the area

Hope this is helpful!

Answer Link

Otras preguntas

For Part A, use a piece of paper. For parts B-D, use the text box below. A. Plot the data on a piece of paper. (make sure you label your axes and put a title).

Mrs canales class is selling pizza to earn money for a field trip. For every pizza sold the class makes $5.35. They have already earned $182.90 toward their $75

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

WILL MARK brainliset answer if gotten right

Numbers from zero to nine are individually selected at random and combined to make a code that contains a six-digit number. Numbers can be repeated. If you were

Michael decided to make French toast. He finds a recipe that calls for the following ingredients: FRENCH TOAST 12 slices of bread 4 eggs 1 cup of milk 1 teaspoo

It happens when a person experience deep grief. *

Can someone give me good websites to find quiz answers on? Like how to find answers on quizzes and test. What websites do y'all use to cheat?? Help a gal out he

Which of the following statements would not translate to the equation 8 ÷ x = -4? A. Eight divided by a number is equal to negative four. B. The solution of a n

22. Which of the following molecules or ions contain polar bonds?