Maya815 Maya815

15-01-2016
Mathematics

contestada

Benny spent half of his allowance going to the movies. He washed the family car and earned nine dollars. What is his allowance if he ended with seventeen dollars?

Respuesta :

AriellaBrown7 AriellaBrown7

15-01-2016

17-9=8
if he spent half of his allowance then you could figure out his original amount of money by adding 8+8=16
so his original allowance was $16

Hope this helps ^_^

Answer Link

Otras preguntas

If C is ¼ of the distance from A to D if A is (3,7) and D is (11,11) where is C?

principles of science

You earn 15n dollars for mowing n lawns. How much do you earn for mowing 1 lawn? 7 lawns?

New customers with Verizon pay a flat rate installation fee plus $45.00 per month for the service. If after nine months, Mr. Burns paid $565, write and solve a

I will mark you brainlest!!!!!!!!! A manufacturer needs to make 16 oz. of an alloy containing 56% nickel. He is going to melt and combine metal x which is 60% n

COMPLETE ANSWER THE ANSWER TO THE QUESTION IS I'M GOING TO VOTE BRAINLIEST PLSSS ASAPCompose a letter informing an applicant that he/she is now HIRED and can st

Please find what the rent per unit needs to be to have a Net Operating Income (NOI) of $100,000. Assumptions Please use the following assumptions below: Rent pe

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

**PLEASE HELP!!** There is considerable evidence that irrigation may have played a pivotal role in the foundation of the earliest civilizations, such as that of

Prove that for any natural number n that number 7^n+4 - 7^n is divisible by 30.