Skullking Skullking

14-03-2018
Biology

contestada

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the above (Question 2) transcription.

Respuesta :

bluenote bluenote

14-03-2018

3’ tcgccctactcgcgtacaccgcgtattgac 5’ turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)

Answer Link

Otras preguntas

describe someone you know (anonymously, of course) who falls into one of the four deviant response categories identifi ed by strain theory. use specifi c charac

considering both the effect of volume and the effect of intermolecular forces, how would the deviation from the ideal behavior of a gas change when the gas is a

the nurse is caring for a client with dysphagia. which interventions would the nurse include in the plan of care? select all that apply. one, some, or all respo

a dealer gains 7% by selling a sofa set for rs 3852 .find his gain percent if he sells it for rs 4050

You are an intern at a local animal sanctuary. one of your tasks is to record how many pounds of bamboo the pandas consume daily for 10 days. write a program to

write a descriptive essay about a man with a long black coat

hi everyone help my math please activity 1 and 2

NO LINKS!!! This problem only Identify the segment bisector of XY. Then find XY. Segment Bisector: XY:

Which of the following is a postzygotic isolation mechanism? Select one: O a. mechanical isolation b. temporal isolation O c. behavioral isolation O d. habitat

Inter conversion of glucose and fructose occurs with an eqilibrium constant of 1.0. glicose isomerase catalyzes this reaction. The final concentration of fructo